Is it possible for two different Affymetrix probe set ID to have common annotations to same gene ?

2010-03-17T16:51:43Z

Is it possible for two different Affymetrix probe set IDs to have common annotations to a single gene ? I am looking for the concept behind Affy probe set IDs. Any literature or links ?

Which software development technique is used in your lab?

2010-03-16T10:09:33Z

On this page of the software carpentry manual you can find a brief introduction to different software development techniques, including agile and sturdy ones.

Which of these development model is closer to the one you use on your lab? How do you work together with your teammates?

note: If you are interested, I can provide you with more documents to describe the different development techniques.

Where to advertise or find bioinformatics jobs

2010-03-15T18:57:44Z

What do you recommend as the most appropriate site to advertise (or look for) bioinformatics related job openings.

How to get started in bioinformatics?

2010-03-16T10:47:33Z

I am a Software Engineering student (with decent background in biology) and would like to explore the field of bioinformatics. I am completely new to the field and would like some pointers on where and how to get started.

Is there any book I should read?
Any interesting online resources?
Any interesting blogs / online communities (apart from this one)?
What are some of the interesting problems bioinformatics is trying to solve?

Any advice or insight about this industry would be appreciated.

A resource to identify functionally redundant genes

2010-03-14T16:26:35Z

Can anybody point me to a resource that provides information on functionally redundant genes? I have been pointed towards the use of GOA (http://www.ebi.ac.uk/GOA/) as one approach. Would this provide sufficient 'resolution' to identify functionally equivalent genes? My thinking is that if two genes share the same GO term and the GO term is a leaf node, that might be useful.

Any pointers would be appreciated

Hardware resources for HPC in Bioinformatics

2010-03-16T22:46:17Z

Greetings everybody,

We're planning to build a very powerful computing machine to serve bioinformatics application here at HCFMUSP(check my profile). I know that the common choice is to build a cluster or go cloud. But our adventurous spirit urges for some experimentation. We are somewhat envious of proprietary solutions using FPGA cards like these ones:

CLCbio Cube

TimeLogic DeCypher

Pico Computing E-FPGA

For the people who never heard of FPGA I do suggest to check out Wikipedia on these topics:

Field Programmable Gate Array Reconfigurable Computing

There are several possible implementations of important algorithms in bioinformatics in those plataforms. This is just one example:

160-fold acceleration of the Smith-Waterman algorithm using a field programmable gate array (FPGA)

Does anybody have some experience with these cards? Do they scale well? Are they worth the trouble?

Cheers, Daniel

I was studying a gene but it disappeared in the latest ensembl release. What should I do now?

2010-03-05T13:06:24Z

I am studying a set of genes involved in the same pathway, but this week, after looking at the new release of ensembl, I discovered that the gene was removed. What should I do now? There are references to this gene in several articles and the fact that it disappeared intrigues me - to which sequence these articles were referring to? Is it possible that the ensembl's curators have made an error?

cheers

Recommend your favorite bioinformatics books

2010-03-05T13:30:44Z

I am looking for personal experiences and short opinions regarding bioinformatics books.

So far I have noticed the following trend: many books titled Bioinformatics with Perl/Python/Java/R etc end up being introductions into the programming language in question, often only minor code examples are related to bioinformatics.

Help us find some good books!

PS. If you are willing to write a standalone book review is even better. Please do so by creating a new question titled: "Book review for X" then answer it with your own review.

What do you consider the most trivial and the most challenging tasks in your particular field of work?

2010-03-13T15:46:57Z

To clarify, I am a biochemist, trained in molecular evolution since undergrad and I changed my particular field of work to large scale phylogenetic analysis in the grad school.

So, to me, building and interpreting a phylogenetic tree from a family of genes can be considered a trivial task in my subfield (actually, this should be be trivial to any people with a background in biology), but to integrate functional data and increase the scale of the analysis to whole genomes and dozen/hundreds of species would be a little more challenging.

I am really curious since bioinformatics and computational biology has had a fast growing in the last years, many paradigms have changed in what is trivial and what is challenging in his many subfields.

Convert microarray quantization in image

2010-03-16T20:56:46Z

How can I convert the microarray quantization mathematically elaborated in the corresponding image? I need to see the image of the mathematic changes in the microarray quantization.

Which human tumor cell line/sample genomes have been already sequenced completely?

2010-03-16T08:39:42Z

Hello,

I am looking for genome (from cell lines or patient samples) that have been fully characterized thanks to the Next Generation Sequencing (NGS) methods. I already know the following instances:

So if you know other papers/ressources I would be glad if you could share it with others.

Thanks in advance,

Fred

Compare two protein sequences using local BLAST

2010-03-15T23:24:58Z

Hi,

I have been given a task to compare the all the protein sequences of a strain of campylobacter with a strain of E.coli. I would like to do this locally using Biopython and the inbuilt Blast tools. However, I'm stuck on how to program this and what tools I should be using. If anybody could point me in the right direction, I would be thankful!

Cheers

Computing the reverse and complement of a sequence with Biopython

2010-03-01T14:26:09Z

An example that computes the reverse complement of a sequence with BioPython

#
# Reverse complement example with BioPython
#

from Bio.Seq import Seq

# a separate function to reverse strings (or other iterables)
def rev(it):
    "Reverses an interable and returns it as a string"
    return ''.join(reversed(it))

# create a Seq class instance
dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")

# original DNA
print type(dna)
print dna

# reverse complement DNA, returns a new sequence
print dna.reverse_complement()

# currently there is no direct way to just reverse a sequence
# we need to do a little extra work

rseq = rev(str(dna))
rdna = Seq(rseq)

# reversed sequence
print rdna

# to complement DNA, returns a new sequence
print dna.complement()

Produces the following output:

<class 'Bio.Seq.Seq'>
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT
GATAGCCCGTGGGAAAGTCGCCGGGTAATGTTACCGGTA
TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC

Mapping SNPs to Pathways

2010-03-04T15:08:48Z

Hi all, given a set of SNPs, what would be your favorite way to find theirs related pathways/ diseases ?

Thanks

Performing BLAST/SmithWaterman searches directly from my application

2010-03-15T07:11:09Z

Bringing in my questions from stackoverflow:

I'm working on a small application and thinking about integrating BLAST or other local alignment searches into my application. My searching has only brought up programs, which need to be installed and called as an external program.

Is there a way short of me implementing it from scratch? Any pre-made library perhaps?

Appropriate podcasts for a bioinformatician?

2010-03-12T09:52:17Z

What podcasts are the bioinformaticians here listening to that tie in with their work?

The most relevant podcast that I know of (the currently even more irregular than normal) Coast to Coast Bio Podcast is still in my list of podcasts.

For programming related topics I still find the StackOverflow podcast an interesting and engaging listen.

Whilst at one point or another I subscribed to both Nature and Science podcasts for general science I no longer do so.

What podcasts might I be missing out on that other people are enjoying related to their work?

How to convert BLAST results to GFF

2010-03-12T17:04:23Z

I'd like to visualise the results of a BLAST search in a genome browser. Is there a simple way to get the results in GFF format without having to write a parser myself?

Programatic technique for gene-name/id conversion

2010-03-11T01:27:26Z

Does anyone know of a good gene-id conversion tool written in Python. I've come across numerous webtools but I'd like something a little more automated. I have the knowledge/ability to do it myself I was just wondering if there was something already out there. There's no point in re-inventing the wheel each time.

Thanks in advance

How to perform tRNA sequence alignment (against a domain-specific tRNA covariance models) with COVE (or Infernal) on windows ?

2010-03-12T13:58:39Z

(Sorry for the long header)

Hello all.

I wish to have a FASTA file (or similar) of a tRNA sequences that are aligned.

Here is an example of a FASTA file I would like to align:

http://gtrnadb.ucsc.edu/Aero_pern/aerPer1-tRNAs.fa

Here is how the sequence would look aligned:

http://gtrnadb.ucsc.edu/Aero_pern/Aero_pern-align.html

It uses a software called COVE, which can be found here:

http://selab.janelia.org/software.html

And it is said to do it by doing: "Structural alignments are generated by aligning tRNA sequences against domain-specific tRNA covariance models with the use of COVE."

Which leads me to my questions:

Where might I find the "domain-specific tRNA" to run the COVE model with ?
How can I do this on windows ?
Is there a better way to do this alignment ?

This is my first question, and I am very new to bioinformatics, so I am sorry if I am missing something very basic, or am asking something to which not many people would know to answer.

Thanks in advance,

Tal

Tools to find gene ontology term enrichment

2010-03-09T18:13:46Z

I need to make a recommendation to people working in a wet-lab looking for an easy to use tool that does GO term enrichment determination. For those unfamiliar with the concept it means that given a list of gene names they want to find out which gene ontology terms are present in numbers that are above random chance.

There is a huge list here yet a random sampling of the tools mentioned there has lead me to many non-working sites. Other tools seem out of date or just not reliable.

What tool do you use to solve this problem?

Thanks.

If I have 4 sequence runs, 2 in each direction, 1 bp is different, on each, should I resequence?

2010-03-10T23:46:35Z

I have a plate of colonies to sequence. I pick 2 colonies and sequence each in Fwd and Rev directions. I get back a single bp difference between the 2 strands. 2 bp have an T, two have a C. How should I call this base? Can I call it a Y (C or T) and leave it at that, or do I need to sequence another colony to be sure?

Unambiguous assembly of next-gen fastq reads into fastq contigs?

2010-03-06T18:22:30Z

Hi,

Does anybody know of any tool that will produce an unambiguous assembly of next-gen fastq files and give the assembled output back as fastq with consensus/combined scores?

By unambiguous I mean something like this in abyss:

ABYSS -k$k -b0 -t0 -e0 -c0

Cheers,

Albert.

How can a base-called position be "unknown" but have a non-minimal score?

2010-03-10T21:26:16Z

Let's say I extract something like this from a qseq or FASTQ file

TTCAGATGTTCATATGCGGATCGGCGCTGGGCCCACGAGATCTAGCAGAGCTCGT.GGGACCACGACCACCGACCC
a`bbbbbbaabbab`ab^`bVa^^bab^[``bba^`]_Ya^`_`^^_Xa\_KYTYD[PY^Y_^[P[V_BBBBBBBB

So the dot is like an N - it can't call the base. So if I look at the FASTQ scores in integer format I would expect that position to have a minimal score. But in fact its score is 'D' or 4, not great but some other called bases at the tail end are 'B' or 2. What gives?

Experiences with cloud computing in bioinformatics

2010-03-04T14:08:04Z

In the past years cloud computing services such as the Amazon's Elastic Compute cloud seem to have emerged a recommended alternative for providing high performance computing.

What are your experiences when it comes to bioinformatics in the cloud?

How to determine if a gene is active from expression data

2010-03-09T02:39:53Z

I have RMA (Robust Multi-Array) scores for the different genes (and their isoforms) on the Affymetrix chip. I want to know which of these genes are "active" (or in other words: are likely to produce enough protein products to have an effect). I'm not interested in them being differentially expressed or X-fold over- or under-expressed. All I want is the classification of them being likely "on" or "off".

So far I log-transformed (basis 10) the RMA score and centered them (subtracted the median). I called all genes which had a transformed score <0 as being inactive and scores >0 as being active.

Does anyone have a better methodology ?

What open source Java library can I use to query online, free databases in which pathways a metabolite is participating?

2010-03-10T11:57:11Z

What opensource Java solutions are available to query online pathway databases like KEGG (or BioMeta), MACiE and Brenda for the pathways a certain metabolite is available, for example, based on the InChI? Preferably, the library would have a good data model for the pathway information, possibly SMBL or RDF-based. What would the code look like to make such a query?

Pfam based functional annotaion

2010-03-04T00:14:24Z

I think in one of the earlier thread, Istvan has already asked about the reliability of GO annotation. I was wondering, if any of you have any experience with the functional annotation based upon the Pfam database. I am looking forward to functionally annotate a large set of peptide library and the easiest way I can think about is to do batch search of those peptides against the Pfam database.In case you guys know a better approach , kindly share it.

cheers

Hierarchical Clustering, Cluster Heat Maps in Java

2010-03-08T12:57:32Z

Hello all, I am new to this forum and I am glad I found one in Bioinformatics too. I hope I can ask this question here. Has anyone been able to generate cluster heatmaps using any library in Java ? I recently got to learn that heatmaps are different from cluster heat maps in just that in the cluster heatmaps there are dendrograms for both genes as well as samples. So essentially Hierarchical clustering (thats what I am working on) is to be performed once on the genes and once on the samples. I was looking at JFreechart, JTreeview. In JFreechart I did not find any method to directly get a cluster heat map. And with JTreeview, it needs 3 input files in particular format like the .CDT file, .gtr file, .atr file. I am curious to know if there is any other direct way to generate these cluster heat maps.

Please enlighten me

Thanks in advance

Which programming languages are good to study for bioinformatics?

2010-01-26T15:45:06Z

This is also a very classic question, however, it can be a very useful discussion for novices which are wishing to work in the bioinformatics field, and have to decide how to organize their time. I have seen some surveys on this, for example on bioinformatics.org and on bioinformaticszen, but none of these cases were open discussions.

Which is your favorite programming language in bioinformatics? I actually use very much of Python and R, and hate Perl :-)

Has enhancer and transcription factor binding site prediction already been made redundant?

2010-03-06T07:43:23Z

ENCODE soon provides DNase I hypersensitivity data for the whole genome in a multitude of different tissues. DNase I hypersensitivity marks genomic positions that are exposed and can hence be used to pinpoint active promoters or enhancers in the studied tissue. DNase I resistant regions, in contrast, mark genomic areas that are protected, e.g. because a transcription factor (TF) is bound. Since the data provides a base-pair resolution, it is possible to "zoom" in on the protected areas (== transcription factor binding sites) of the otherwise exposed regions (== enhancers). One can hence identify the shadow-prints on the genome left by the regulatory TFs in a given tissue. To identify which TFs are casting the shadows one could use ChIP-seq (rough binding regions) or Protein Binding Arrays (binding motif).

The question is: has the in-silico prediction of enhancers, binding sites or partners still merit or will we be soon able to look-up the binding events of TFs in the different tissues?

Top Questions - BioStar

Is it possible for two different Affymetrix probe set ID to have common annotations to same gene ?

Which software development technique is used in your lab?

Where to advertise or find bioinformatics jobs

How to get started in bioinformatics?

A resource to identify functionally redundant genes

Hardware resources for HPC in Bioinformatics

I was studying a gene but it disappeared in the latest ensembl release. What should I do now?

Recommend your favorite bioinformatics books

What do you consider the most trivial and the most challenging tasks in your particular field of work?

Convert microarray quantization in image

Which human tumor cell line/sample genomes have been already sequenced completely?

Compare two protein sequences using local BLAST

Computing the reverse and complement of a sequence with Biopython

Mapping SNPs to Pathways

Performing BLAST/SmithWaterman searches directly from my application

Appropriate podcasts for a bioinformatician?

How to convert BLAST results to GFF

Programatic technique for gene-name/id conversion

How to perform tRNA sequence alignment (against a domain-specific tRNA covariance models) with COVE (or Infernal) on windows ?

Tools to find gene ontology term enrichment

If I have 4 sequence runs, 2 in each direction, 1 bp is different, on each, should I resequence?

Unambiguous assembly of next-gen fastq reads into fastq contigs?

How can a base-called position be "unknown" but have a non-minimal score?

Experiences with cloud computing in bioinformatics

How to determine if a gene is active from expression data

What open source Java library can I use to query online, free databases in which pathways a metabolite is participating?

Pfam based functional annotaion

Hierarchical Clustering, Cluster Heat Maps in Java

Which programming languages are good to study for bioinformatics?

Has enhancer and transcription factor binding site prediction already been made redundant?