Question

I have a few hundred yeast sequences (20-80bp long) and I want to find common motifs (conserved bases at certain indices) in them. I am using a Mac

Answer 1

You can also use MEME: http://meme.sdsc.edu/.

Answer 2

The first step when looking for conservation of single bases or motives is often a multiple sequence alignment that will align the sequences in a way such that conserved regions are best visible. This can be a first step before using explicit motif finders like MEME. A good way of visualizing multiple alignments is the sequence-logo that will give a graphical representation of base conservation.

Here is the wikipedia list of mult.-sequence alignment tools.

I recommend to start with the EBI web-server of ClustalW though, if that is not enough you can also try MAFFT or T-Coffee.

Weblogo can generate sequence-logo graphics from the output and also from fasta input directly.

Advantage of these tools is that you don't need to install them, so good for a first attempt irrespective of using a Mac.

Answer 3

try this out?

http://fraenkel.mit.edu/webmotifs/form.html

Answer 4

Meme has been the first program to be published for doing that. As an alternative you can find one of the EMBOSS tools; if you are scared by a terminal and want to do it from a web-based interface, you can use the EMBOSS tools from galaxy

Answer 5

Some time ago I used SOMBRERO (http://bioinf.nuigalway.ie/sombrero/download.html) with a good degree of success on finding motifs in a very diverse set of sequences. They have a Mac version for download as well as parallel versions for Irix and Linux.

Answer 6

You may check out these pages:

Bioinfo_tutorial#Promoter_prediction

Wikiomics:Sequence_motifs

These are ca 2 years old (links may not work etc.) but as a starting point should be OK. Also in unlikely case you did not found it yet: in yeast there has been an extensive motif search study done by Kellis with insane number of citations:

Nature. 2003 May 15;423(6937):241-54.

Kellis M, Patterson N, Endrizzi M, Birren B, Lander ES.

Sequencing and comparison of yeast species to identify genes and regulatory elements.

Answer 7

ACGGGCCCGACGATGCGTCGTA

ACGTACGTCGAACCGTCGTCGT

ACGTGCGTCGAAACGTCAGTCG

ACGGGTTCGATCGTCGTCGTCG

may be in Python I will break down the first sequence of required motif length into a sliding window and will search for those list of motifs in the rest of sequences using regular expression in python using re.search() method.